Más notícias envolvidas em proteínas: Como é o coronavírus?

Um vírus é “simplesmente uma notícia ruim embrulhada em proteína”, escreveram os biólogos Jean e Peter Medawar em 1977.

Em janeiro, os cientistas decifraram uma notícia muito ruim: o genoma do SARS-CoV-2, o vírus que causa o Covid-19. A amostra veio de um homem de 41 anos que trabalhava no mercado de frutos do mar em Wuhan, onde apareceu o primeiro grupo de casos.

Agora, os pesquisadores estão correndo para entender essa receita viral, que pode inspirar medicamentos, vacinas e outras ferramentas para combater a pandemia em curso.

Uma cadeia de RNA

Os vírus devem sequestrar células vivas para se replicar e se espalhar. Quando o coronavírus encontra uma célula adequada, ele injeta uma cadeia de RNA que contém todo o genoma do coronavírus.

O genoma do novo coronavírus tem menos de 30.000 “letras”. (O genoma humano tem mais de 3 bilhões.) Os cientistas identificaram genes para até 29 proteínas, que realizam uma variedade de trabalhos, desde a cópia de coronavírus até a supressão das respostas imunes do corpo.

A primeira sequência de letras de RNA diz:

“auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag”

Essa sequência recruta máquinas dentro da célula infectada para ler as letras de RNA – a, c, ge – e traduzi-las em proteínas de coronavírus.

Uma cadeia de proteínas · ORF1ab

A primeira proteína viral criada dentro da célula infectada é na verdade uma cadeia de 16 proteínas unidas. Duas dessas proteínas agem como tesouras, cortando os elos entre as diferentes proteínas e liberando-as para o trabalho. A pesquisa em outros coronavírus deu aos cientistas uma boa compreensão do que algumas das proteínas SARS-CoV-2 fazem. Mas outras proteínas são muito mais misteriosas e algumas podem não fazer nada.

Na imagem acima, a primeira linha contém o genoma do SARS-CoV-2; Na segunda linha temos a proteína ORF1ac e outras proteínas estruturais, e na terceira linha temos as proteínas não-estruturais e outras proteínas “acessório”.


Sabotador Celular · NSP1

Essa proteína diminui a produção de células próprias da célula infectada. Essa sabotagem força a célula a produzir mais proteínas virais e impede a montagem de proteínas antivirais que poderiam parar o vírus.

Proteína Misteriosa · NSP2

Os cientistas não têm certeza do que o NSP2 faz. As outras proteínas às quais ele se liga podem oferecer algumas pistas. Dois deles ajudam a mover bolhas cheias de moléculas chamadas endossomas pela célula.

Desmarcando e cortando · NSP3

O NSP3 é uma proteína grande que possui dois trabalhos importantes. Um deles é cortar outras proteínas virais para que eles possam realizar suas próprias tarefas. Também altera muitas das proteínas da célula infectada.

Normalmente, uma célula saudável identifica proteínas antigas para destruição. Mas o coronavírus pode remover essas tags, alterando o equilíbrio de proteínas e possivelmente reduzindo a capacidade da célula de combater o vírus.

Fabricante de bolhas · NSP4

Combinando com outras proteínas, o NSP4 ajuda a criar bolhas cheias de líquido nas células infectadas. Dentro dessas bolhas, partes para novas cópias do vírus são construídas.

Tesoura protéica · NSP5

Essa proteína faz a maioria dos cortes que liberam outras proteínas NSP para realizar seus próprios trabalhos.

Fábrica de bolhas · NSP6

Funciona com o NSP3 e o NSP4 para fazer bolhas na fábrica de vírus.

Assistentes de cópia · NSP7 e NSP8

Essas duas proteínas ajudam o NSP12 a fazer novas cópias do genoma do RNA, que podem acabar acabando em novos vírus.

No coração da célula · NSP9

Essa proteína se infiltra em pequenos canais no núcleo da célula infectada, que contém nosso próprio genoma. Pode ser capaz de influenciar o movimento de moléculas dentro e fora do núcleo – mas com que finalidade ninguém sabe.

Camuflagem genética · NSP10

As células humanas possuem proteínas antivirais que encontram o RNA viral e o fragmentam. Essa proteína trabalha com o NSP16 para camuflar os genes do vírus, para que não sejam atacados.

Copiadora · NSP12

Essa proteína reúne letras genéticas em novos genomas de vírus. Os pesquisadores descobriram que o remdesivir antiviral interfere com o NSP12 em outros coronavírus, e agora estão em andamento estudos para verificar se o medicamento pode tratar o Covid-19.

Desenrolando RNA · NSP13

Normalmente, o RNA do vírus é enrolado em voltas e mais voltas intrincadas. Os cientistas suspeitam que o NSP13 o desenrola para que outras proteínas possam ler sua sequência e fazer novas cópias.

Revisor Viral · NSP14

Como o NSP12 duplica o genoma do coronavírus, às vezes ele adiciona uma letra errada à nova cópia. O NSP14 elimina esses erros, para que a letra correta possa ser adicionada.

Limpeza · NSP15

Os pesquisadores suspeitam que essa proteína retire o RNA do vírus restante como uma maneira de se esconder das defesas antivirais da célula infectada.

Mais camuflagem · NSP16

O NSP16 trabalha com o NSP10 para ajudar os genes do vírus a se esconderem das proteínas que cortam o RNA viral.

Proteína Spike · S

A proteína spike é uma das quatro proteínas estruturais – S, E, M e N – que formam a camada externa do coronavírus e protegem o RNA interno. As proteínas estruturais também ajudam a montar e liberar novas cópias do vírus.

As proteínas S formam picos proeminentes na superfície do vírus, organizando-se em grupos de três. Esses espigões em forma de coroa dão nome aos coronavírus.

Parte do pico pode se estender e se ligar a uma proteína chamada ACE2 (em amarelo abaixo), que aparece em células específicas das vias aéreas humanas. O vírus pode então invadir a célula.

O gene da proteína spike no SARS-CoV-2 possui uma inserção de 12 letras genéticas: ccucggcgggca. Essa mutação pode ajudar os espinhos a se ligarem firmemente às células humanas – um passo crucial em sua evolução a partir de um vírus que infectou morcegos e outras espécies.

Várias equipes científicas estão projetando vacinas que podem impedir que os picos se liguem às células humanas.

Artista de Fuga · ORF3a

O genoma SARS-CoV-2 também codifica um grupo das chamadas “proteínas acessórias”. Eles ajudam a mudar o ambiente dentro da célula infectada para facilitar a replicação do vírus.

A proteína ORF3a abre um buraco na membrana de uma célula infectada, facilitando a fuga de novos vírus. Também provoca inflamação, um dos sintomas mais perigosos do Covid-19.

Proteína do envelope · E

A proteína do envelope é uma proteína estrutural que ajuda a formar a bolha oleosa do vírus. Também pode ter trabalhos a fazer quando o vírus estiver dentro da célula. Os pesquisadores descobriram que ele se prende às proteínas que ajudam a ativar e desativar nossos próprios genes. É possível que o padrão mude quando a proteína E interfere.

Proteína de membrana · M

Outra proteína estrutural que faz parte do revestimento externo do vírus.

Bloqueador de sinais · ORF6

Essa proteína acessória bloqueia os sinais que a célula infectada envia para o sistema imunológico. Ele também bloqueia algumas das próprias proteínas de combate a vírus da célula, as mesmas alvo de outros vírus, como a poliomielite e a gripe.

Libertador de vírus · ORF7a

Quando novos vírus tentam escapar de uma célula, a célula pode capturá-los com proteínas chamadas tetherina. Algumas pesquisas sugerem que o ORF7a reduz o suprimento de tetherina de uma célula infectada, permitindo que mais vírus escapem. Os pesquisadores também descobriram que a proteína pode desencadear células infectadas para cometer suicídio – o que contribui para os danos que o Covid-19 causa nos pulmões.

Proteína Misteriosa · ORF8

O gene para esta proteína acessória é dramaticamente diferente na SARS-CoV-2 do que em outros coronavírus. Os pesquisadores estão debatendo o que faz.

Proteína Nucleocapsídica · N

A proteína N protege o RNA do vírus, mantendo-o estável dentro do vírus. Muitas proteínas N se ligam em uma longa espiral, envolvendo e enrolando o RNA:

A proteína N protege o RNA do vírus, mantendo-o estável dentro do vírus. Muitas proteínas N se ligam em uma longa espiral, envolvendo e enrolando o RNA:

Proteína Misteriosa · ORF10

Parentes próximos do vírus SARS-CoV-2 não possuem o gene para esta pequena proteína acessória, por isso é difícil saber para que serve ainda – ou mesmo se o vírus produz proteínas a partir dele.

O genoma do coronavírus termina com um trecho de RNA que interrompe o mecanismo de produção de proteínas da célula. Em seguida, ele desaparece como uma sequência repetida de aaaaaaaaaaaaa

caaucuuuaaucaguguguaacauuagggaggacuacauaagagccaccacauuuucaccgaggccacgcggaguacgaucgaguguacagugaacaaugcuagggagagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

Nota: As quatro letras do DNA são A, C, G e T. Nas moléculas de RNA, como o genoma do coronavírus, o T (timina) é substituído por U (uracil).

Fontes: Fan Wu et al., Nature; Centro Nacional de Informação Biotecnológica; Dr. David Gordon, Universidade da Califórnia, São Francisco; Dr. Matthew B. Frieman e Dr. Stuart Weston, Faculdade de Medicina da Universidade de Maryland; Dr. Pleuni Pennings, Universidade Estadual de São Francisco; Jornal de Virologia; Revisão Anual de Virologia.

Fontes do modelo: Coronavírus por Maria Voigt, RCSB Protein Data Bank com sede na Universidade Rutgers – New Brunswick; Ribossoma de Heena Khatter et al., Nature; Proteínas do Grupo de Pesquisa de Yang Zhang, Universidade de Michigan.

Fonte: NY Times

0 0 vote
Article Rating
Subscribe
Notify of
guest

Esse site utiliza o Akismet para reduzir spam. Aprenda como seus dados de comentários são processados.

0 Comentários
Inline Feedbacks
View all comments